Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects

Giri, Bishnubasu and Saini, Taruna and Kumbhakar, Sadananda and Selvan K, Kalai and Muley, Arabinda and Misra, Ashish and Maji, Somnath (2020) Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects. Dalton Transactions, 49 (31). pp. 10772-10785. ISSN 1477-9226

Full text not available from this repository. (Request a copy)

Abstract

Polypyridyl backbone nitrosyl complexes of ruthenium with the molecular framework [RuII(antpy)(bpy)NO+/]n+ [4](PF6)3 (n = 3), [4](PF6)2 (n = 2), where antpy = 4′-(anthracene-9-yl)-2,2′:6′,2′′-terpyridine and bpy = 2,2′-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [RuII(antpy)(bpy)(Cl)](PF6) [1](PF6) and [RuII(antpy)(bpy)(CH3CN)](PF6)2 [2](PF6)2 and [RuII(antpy)(bpy)(NO2)](PF6) [3](PF6). After column chromatographic purification, all the synthesized complexes were fully characterized using different spectroscopic and analytical techniques including mass spectroscopy, 1H NMR, FT-IR and UV-vis spectrophotometry. The Ru-NO stretching frequency of [4](PF6)3 was observed at 1941 cm-1, which suggests moderately strong Ru-NO bonding. A massive shift in the νNO frequency occurred at Δν = 329 cm-1 (solid) upon reducing [4](PF6)3 to [4](PF6)2. To understand the molecular integrity of the complexes, the structure of [3](PF6) was successfully determined by X-ray crystallography. The redox properties of [4](PF6)3 were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF6)3 and [4](PF6)2 were determined to be 8.01 × 10-3 min-1 (t1/2 ∼ 86 min) and 3.27 × 10-2 min-1 (t1/2 ∼ 21 min), respectively, when exposed to a 200 W Xenon light. Additionally, the photo-cleavage of Ru-NO occurred within ∼2 h when [4](PF6)3 was irradiated with an IR light source (>700 nm) at room temperature. The first-order rate constant of 9.4 × 10-3 min-1 (t1/2 ∼ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biologically relevant target protein. The one-electron reduction of [4](PF6)3 to [4](PF6)2 was systematically carried out chemically (hydrazine hydrate), electrochemically and biologically. In the biological reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF6)3 exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC50 ∼ 8.97 μM).

[error in script]

IITH Creators:

IITH Creators	ORCiD
Giri, Bishnubasu	UNSPECIFIED
Saini, Taruna	UNSPECIFIED
Kumbhakar, Sadananda	UNSPECIFIED
Selvan K, Kalai	UNSPECIFIED
Muley, Arabinda	UNSPECIFIED
Misra, Ashish	UNSPECIFIED
Maji, Somnath	http://orcid.org/0000-0001-6047-1339

Item Type:

Article

Uncontrolled Keywords:

Biological reductions; Chromatographic purification; First-order rate constants; Molecular frameworks; One-electron reductions; Prostate cancer cells; Stretching frequency; UV-vis spectrophotometry

Subjects:

Chemistry

Divisions:

Department of Chemistry

Depositing User:

. LibTrainee 2021

Date Deposited:

12 Jul 2021 05:39

Last Modified:

12 Jul 2021 05:39

URI:

http://raiithold.iith.ac.in/id/eprint/8232